Información

¿Qué clase de inhibidor de histona desacetilasa (HDAC) es el valproato de sodio (VPA)?

¿Qué clase de inhibidor de histona desacetilasa (HDAC) es el valproato de sodio (VPA)?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

VPA es un inhibidor de HDAC conocido. Pero no puedo encontrar de qué clase es.

Que clase es

¿Y hay algún método para encontrar una respuesta mejor que forcejear con Google?


Esto se explica en la página de WP para HDAC. Hay cinco clases:

ácidos hidroxámicos (o hidroxamatos), como tricostatina A

tetrapéptidos cíclicos (como la trapoxina B) y los depsipéptidos

benzamidas

cetonas electrofílicas

los compuestos de ácido alifático como fenilbutirato y ácido valproico

y el valproato está en la clase final, ácidos alifáticos.


Ácido valproico

El ácido valproico (VPA) es un ácido graso de cadena corta que actúa como modificador epigenético al inhibir las histonas desacetilasas (HDAC) con valores de CI₅₀ que oscilan entre 0,4 y 3 mM. El VPA también puede aumentar los niveles de ácido γaminobutírico (GABA) mediante la inhibición de las enzimas involucradas en el metabolismo de GABA. Otros efectos incluyen el agotamiento del inositol celular al inhibir la mioinositol-1-fosfato sintasa. (Gottlicher et al., Khan et al., Phiel et al., Rosenberg)

REPROGRAMACIÓN
· Permite la reprogramación química (sin factores genéticos) de fibroblastos embrionarios de ratón a células madre pluripotentes inducidas (iPS), en combinación con CHIR99021, forskolina, tranilcipromina, 3-desazaneplanocina A y E-616452 (Hou et al.).
· Aumenta la eficiencia de reprogramación de fibroblastos embrionarios de ratón a células iPS (Huangfu et al. 2008a).
· Promueve la reprogramación de fibroblastos humanos a células iPS utilizando solo 2 factores, OCT4 y SOX2 (Huangfu et al. 2008b).
· Reprogramación de linaje directo de fibroblastos a neuronas maduras, en combinación con CHIR99021, RepSox, Forskolin, SP600125, Gö6983 e Y-27632 (Hu et al.).

MANTENIMIENTO Y AUTORRENOVACIÓN
· Media la expansión ex vivo de células madre y progenitoras hematopoyéticas CD34 + de sangre de cordón umbilical (Chaurasia et al.).
· Promueve la proliferación y autorrenovación de células progenitoras hematopoyéticas humanas y de ratón (Bug et al., De Felice et al.).

DIFERENCIACIÓN
· Promueve la diferenciación de neuronas y suprime la diferenciación de astrocitos y oligodendrocitos de células progenitoras neurales de rata (Hsieh et al., Jung et al.).
· Promueve la diferenciación osteogénica de las células madre mesenquimales humanas (Cho et al.).


Introducción

El neuroblastoma es la principal causa de muerte por neoplasia en la infancia (Maris y Mathay, 1999). Estos tumores extracraneales sólidos son biológicamente heterogéneos, con poblaciones celulares que difieren en sus programas genéticos, etapa de maduración y potencial maligno (Brodeur, 2003). El neuroblastoma de bajo riesgo es una de las neoplasias malignas humanas raras que se sabe que demuestran una regresión espontánea en los bebés de un estado indiferenciado a una formación celular completamente benigna (ganglioneuroma), mientras que el neuroblastoma de alto riesgo crece sin descanso y puede ser rápidamente fatal. El pronóstico de la forma de cáncer de alto riesgo es malo, porque la resistencia a los fármacos surge en la mayoría de esos pacientes, que inicialmente responden a la quimioterapia (Brodeur, 2003).

El neuroblastoma consta de dos células neoplásicas principales (Voigt et al., 2000 Hopkins-Donaldson et al., 2004): i) neuroblásticas o tipo N: células citoplasmáticas indiferenciadas, redondas y pequeñas y escasas y ii) estromales o tipo S: células grandes hialinas, aplanadas y diferenciadas adherentes. Como las células del neuroblastoma parecen tener la capacidad de diferenciarse espontáneamente en vivo y in vitro (Morgenstern et al., 2004), su heterogeneidad podría afectar el resultado del tratamiento, en particular la respuesta a la apoptosis inducida por la quimioterapia.

Para lograr el concepto de tratamiento más adecuado, los medicamentos generalmente se usan en varias combinaciones. Los agentes comúnmente utilizados en el tratamiento del neuroblastoma son compuestos de platino (cisplatino, carboplatino), agentes alquilantes (ciclofosfamida, ifosfamida, melfalán), inhibidores de la topoisomerasa II (etopósido), antibióticos de antraciclina (doxorrubicina) y alcaloides de la vinca (vincristina). Algunos regímenes novedosos también incluyen inhibidores de la topoisomerasa I (topotecán e irinotecán) que son eficaces contra la enfermedad recurrente (Brodeur, 2003).

Debido a que la estructura epigenética del ADN y sus lesiones juegan un papel en el origen de los neuroblastomas humanos, la manipulación farmacéutica del epigenoma puede ofrecer otras opciones de tratamiento también para los neuroblastomas (Furchert et al., 2007). Las histonas desacetilasas (HDAC) y las histonas acetil transferasas modifican las proteínas histonas y contribuyen a un código epigenético reconocido por las proteínas implicadas en la regulación de la expresión génica (Marks et al., 2003, 2004 Hooven et al., 2005). De hecho, estudios anteriores demostraron la citotoxicidad de los inhibidores de HDAC en varias células de neuroblastoma, lo que resultó en la inhibición del crecimiento de estas células tumorales (Cinatl et al., 1996 Michaelis et al, 2004, 2007 Furchert et al., 2007). En células neoplásicas, donde se detectó con frecuencia la sobreexpresión de diferentes HDAC (para un resumen, ver Bolden et al, 2006), la abundancia de histonas desacetiladas generalmente se asocia con la hipermetilación del ADN y el silenciamiento de genes (Santini et al., 2007). El tratamiento con inhibidores de HDAC indujo la reactivación de genes reguladores del crecimiento y consecuentemente la apoptosis en estas células. Uno de los inhibidores de HDAC, el ácido valproico (VPA), inhibe el crecimiento e induce la diferenciación de las células UKF-NB-2 y UKF-NB-3 del neuroblastoma humano. in vitro en concentraciones que van de 0,5 a 2 mM que se han logrado en humanos sin efectos adversos significativos (Cinatl et al., 1996). Sin embargo, la información sobre los efectos del VPA y otros inhibidores de HDAC en células de neuroblastoma adicionales es escasa. Por lo tanto, aquí ampliamos este estudio investigando el efecto de VPA y otro inhibidor de HDAC, tricostatina A (TSA), en otras líneas celulares de neuroblastoma. Debido a que la heterogeneidad de las células del neuroblastoma podría afectar su tratamiento, se probaron dos tipos de líneas celulares de neuroblastoma para determinar su respuesta al tratamiento con VPA y TSA. Además del efecto de VPA y TSA en las células UKF-NB-3 (el tipo N invasivo), el de las líneas celulares UKF-NB-4 y SK-N-AS (el tipo S no invasivo y menos agresivo) ) fue investigado en este trabajo.

Además, se sabe que el VPA y la TSA son metabolizados por las enzimas de biotransformación del citocromo P450 (CYP) y pueden aumentar y / o disminuir sus actividades y / o expresión, lo que afecta los mecanismos que controlan la disposición del fármaco (Fisher et al., 1991 Rogiers et al., 1992, 1995 Isoj & # x000e4rvi et al., 2001 Wen et al., 2001 Bort et al., 2004 Cerveny et al., 2007 Nelson-DeGrave et al., 2004 Hooven et al., 2005 Snykers et al., 2007 Kiang et al., 2006). Debido a que se encontró que varias enzimas CYP que metabolizan una variedad de fármacos (CYP1A1, 1B1 y 3A4) se expresan en células de neuroblastoma (Poljakov & # x000e1 et al., 2009), aquí también investigamos si su expresión está influenciada por VPA y TSA en estas células.


El valproato de sodio, un inhibidor de la histona desacetilasa, provoca citotoxicidad mediada por especies de oxígeno reactivo en células de carcinoma hepatocelular humano

Valproato de sodio (SV), una nueva clase de inhibidores de histonas desacetilasas (HDAC) que se utilizan comúnmente como fármaco antiepiléptico. Se sabe que los inhibidores de HDAC poseen potenciales anticancerígenos. En este estudio, investigamos el potencial citotóxico de SV en la línea celular de carcinoma hepatocelular humano (células HepG2).

Métodos

Se utilizó el ensayo MTT para analizar la citotoxicidad. La expresión de ROS intracelulares y del citocromo c se analizó mediante microscopía de fluorescencia. La apoptosis relacionada con la morfología se analizó mediante tinción dual con naranja de acridina / bromuro de etidio. La expresión de la proteína caspasa 3 se investigó mediante análisis de transferencia Western.

Resultados

Los tratamientos con valproato de sodio en células HepG2 causaron una citotoxicidad significativa y dependiente de la dosis. Las ROS intracelulares aumentaron notablemente en las células que se tratan con SV y causaron apoptosis temprana y tardía como se evidencia por la tinción dual. Las células tratadas con SV expresaron la expresión de la proteína citocromo cy caspasa 3.

Conclusión

Estos resultados sugieren los potenciales citotóxicos de SV en células HepG2. Este estudio puede dar una pista importante para la inclusión de SV como adyuvante junto con agentes anticancerígenos estándar después de los estudios clínicos e in vivo necesarios.


El análisis transcripcional del valproato de sodio en una línea celular serotoninérgica revela la regulación génica a través de mecanismos independientes y dependientes de la inhibición de HDAC

El valproato de sodio (VPA) es un inhibidor de la histona desacetilasa (HDAC), que se prescribe ampliamente en el tratamiento del trastorno bipolar y, sin embargo, no se comprenden completamente los modos precisos de acción terapéutica de este fármaco. Después de la exposición de la línea celular serotoninérgica de rata RN46A a VPA, el análisis de secuenciación de ARN (ARN-Seq) mostró cambios generalizados en la expresión génica. El análisis por múltiples conductos reveló que hasta 230 genes estaban significativamente regulados al alza y 72 genes estaban significativamente regulados a la baja. Se seleccionó un subconjunto de 23 genes expresados ​​diferencialmente para su validación utilizando la plataforma nCounter®, y de estos obtuvimos una validación sólida para ADAM23, LSP1, MAOB, MMP13, PAK3, SERPINB2, SNAP91, WNT6, y ZCCHC12. Investigamos el efecto del litio en este subconjunto y encontramos cuatro genes, CDKN1C, LSP1, SERPINB2 y WNT6 co-regulado por litio y VPA. También exploramos los efectos de otros inhibidores de HDAC y el análogo de VPA valpromida en el subconjunto de 23 genes seleccionados. Expresión de ocho de estos genes, CDKN1C, MAOB, MMP13, NGFR, SHANK3, VGF, WNT6 y ZCCHC12, fue modificado por inhibición de HDAC, mientras que otros no parecieron responder a varios inhibidores de HDAC probados. Estos resultados sugieren que el VPA puede regular genes a través de mecanismos independientes y dependientes de HDAC. Comprender los efectos reguladores de genes más amplios del VPA en este modelo de células serotoninérgicas debería proporcionar información sobre cómo funciona este fármaco y si otros compuestos de HDACi pueden tener efectos reguladores de genes similares, además de destacar los procesos moleculares que pueden ser la base de la regulación del estado de ánimo.


Discusión

El osteosarcoma sigue siendo el tumor óseo primario más común y se desarrolla con mayor frecuencia en los huesos largos durante la adolescencia [24]. La causa de muerte de la gran mayoría de estos pacientes sigue siendo el desarrollo de metástasis, principalmente en los pulmones, ya que la insuficiencia local en pacientes con tumores apendiculares se ha minimizado gracias a las mejoras en el tratamiento del tumor primario [27]. Si bien el desarrollo de protocolos de quimioterapia multimodal para la SG en la década de 1980 proporcionó mejoras significativas en los resultados a largo plazo para los pacientes que presentaban una enfermedad localizada, esto no ha sido así para los pacientes en los que hay metástasis en el momento del diagnóstico, y menos de El 30% de estos pacientes sobreviven [24, 27]. Los factores que se han correlacionado con la supervivencia a largo plazo en pacientes con SG incluyen el grado de necrosis del tumor primario después de un protocolo intensificado de quimioterapia multimodal antes de la amputación quirúrgica o del procedimiento de rescate de la extremidad [28]. Las toxicidades inaceptables impiden que una mayor intensificación de la dosis proporcione una mejora adicional en la supervivencia a largo plazo. El uso de agentes dirigidos a cambios epigenéticos es un ejemplo de la tendencia reciente en la terapia del cáncer de combinar agentes biológicamente dirigidos con quimioterapia citotóxica.

En nuestro presente estudio, encontramos que el inhibidor de HDAC VPA puede sensibilizar a las células OS humanas y caninas a los efectos antitumorales del inhibidor de la topoisomerasa-II DOX. Como agente único, el VPA demostró solo efectos antiproliferativos modestos en el rango de concentración que se considera alcanzable in vivo. Si bien el tratamiento simultáneo con ambos agentes pudo producir un aumento en la sensibilidad a la DOX, la quimiosensibilización más profunda se observó con el pretratamiento con VPA de 48 h. Esto podría explicarse por la descondensación de la cromatina inducida por VPA, lo que permite un mayor acceso de DOX al ADN. Esta dependencia del programa también ha sido informada por otros que evalúan diferentes combinaciones de inhibidores de HDAC y macromoléculas intercaladas in vitro e in vivo [29]. Curiosamente, la neutralización de carga parcial provocada por la hiperacetilación de las colas de histonas puede ser solo en parte responsable de la descondensación de la cromatina después de la exposición a inhibidores de HDAC. Las alteraciones en los niveles de expresión de proteínas que son importantes para mantener la estructura de la cromatina (SMC) se han visto implicadas en este cambio conformacional [14]. La combinación de asociaciones disminuidas de las colas de histonas con el ADN y la reducción de los niveles de proteínas que mantienen la estructura de la cromatina puede explicar las reducciones en DOX IC50 en las células OS pretratadas con VPA en comparación con las que se co-incubaron.

También encontramos que la disminución del número de células viables observada con la terapia de combinación se debía, al menos en parte, a un aumento de la apoptosis. Los ensayos de caspasa y anexina V / PI revelaron que la adición de VPA al tratamiento con DOX aumentó significativamente el índice apoptótico de las células OS in vitro, y esto se asoció con una mayor acumulación de DOX nuclear en estas mismas células. Encontramos resultados idénticos in vivo, con la adición de VPA que proporcionó un aumento significativo en el porcentaje de células tumorales positivas a TUNEL en comparación con los ratones tratados con DOX solo. Estos resultados son particularmente notables a la luz del hecho de que el aumento de la muerte de las células tumorales en los tumores primarios de SG después de la quimioterapia neoadyuvante se asocia con una mejor supervivencia a largo plazo en pacientes humanos [28]. De manera similar, también se ha descrito en perros una correlación directa entre el porcentaje de necrosis después de la terapia con DOX y el tiempo de supervivencia [30]. Además de la actividad apoptótica mejorada, nuestros resultados de la evaluación del marcador de proliferación Ki-67 muestran que la combinación de VPA y DOX también tiene un mayor efecto antiproliferativo que cualquier agente solo.

Demostramos mediante un análisis occidental que el tratamiento in vitro de células OS humanas y caninas con VPA da como resultado una hiperacetilación similar de la histona H3 utilizando concentraciones que se pueden alcanzar en los pacientes. También se observó hiperacetilación in vivo, aunque no se observó un aumento de la actividad antitumoral con el tratamiento con VPA de agente único a corto plazo en comparación con los controles. Aunque no se ha demostrado que sea un predictor de la actividad antitumoral en células tratadas con HDACi como agente único, la evaluación de la acetilación de histonas tumorales in vivo puede ser útil para evaluar la farmacodinámica del VPA al determinar la dosificación óptima en combinación con DOX, como descondensación de cromatina. y un mayor acceso al ADN puede requerir hiperacetilación de histonas.

La tasa de incidencia relativamente baja de SG en humanos es un obstáculo significativo para desarrollar y evaluar rigurosamente combinaciones de tratamientos novedosos y diseñar ensayos clínicos que generarán datos de resultados significativos. Por el contrario, la incidencia de SG de aparición espontánea en pacientes caninos es aproximadamente 8 & # x0201312 veces mayor [31]. Estos tumores caninos son histológicamente indistinguibles de sus homólogos humanos y comparten características comunes como agresividad biológica, tasas de respuesta, propensión a hacer metástasis en los pulmones, predilecciones de sitios anatómicos y factores de pronóstico [31 & # x0201333]. Los estudios en pacientes caninos con SG espontánea han demostrado ser útiles para desarrollar nuevas estrategias terapéuticas para humanos. Un estudio aleatorizado, doble ciego en pacientes caninos que utilizó una forma encapsulada en liposomas del compuesto activador de macrófagos muramil tripéptido fosfatidiletanolamina (L-MTPPE) demostró una mejora significativa en la supervivencia libre de eventos después de la amputación [34], cuyos resultados llevaron a un gran ensayo de fase III aleatorizado en pacientes humanos con OS [35]. Nuestro estudio actual ilustra la similitud entre las células OS caninas y humanas en sus respuestas moleculares a la inhibición de HDAC por VPA, proporcionando más evidencia de que la OS que ocurre espontáneamente en perros puede proporcionar un modelo sólido para desarrollar nuevas estrategias epigenéticas que pueden mejorar aún más los resultados a largo plazo.

En conclusión, hemos demostrado que el VPA es capaz de inhibir eficazmente la HDAC en células OS humanas y caninas, lo que da como resultado una hiperacetilación de histonas. Además, el pretratamiento de estas células con VPA da como resultado una mayor sensibilidad a DOX in vitro y una profunda inhibición del crecimiento tumoral in vivo. También encontramos que la disminución de los marcadores de proliferación y el aumento de la apoptosis eran secuelas de la terapia de combinación VPA-DOX en un modelo de xenoinjerto de OS canino. Este estudio proporciona más apoyo al uso de inhibidores de HDAC como medio de quimiosensibilización en el tratamiento del cáncer y, más específicamente, la integración de inhibidores de HDAC en protocolos de quimioterapia citotóxica en OS. La SG canina espontánea puede servir como un puente traslacional novedoso para la evaluación de estas combinaciones.


RESULTADOS

Efectos del VPA en el desarrollo: retraso, malformación axial y defectos de pigmentación en dos especies

Nuestra estrategia fue caracterizar el fenotipo inducido por VPA de múltiples formas para proporcionar numerosos criterios para compararlo con los fenotipos inducidos por compuestos estructuralmente relacionados (análogos de VPA y butirato de sodio [NaBu]) y un compuesto inhibidor de HDAC sin relación estructural, TSA .

Los embriones de pez cebra se trataron con VPA desde las etapas de epibolia media a tardía (gástrula temprana) y se puntuaron a las 24 h. A ≤0.01 mM VPA, no se observaron efectos brutos. Las concentraciones de VPA ≥3 mM fueron citotóxicas, lo que provocó una rápida detención del desarrollo y lisis celular. La malformación a nivel general se hizo más obvia a medida que avanzaba el desarrollo y era particularmente notoria, incluso a dosis bajas de VPA, como una cola doblada o torcida (Fig. 1). A dosis más altas, los embriones de pez cebra mostraron una falta de pigmentación (Fig. 1). Xenopus los embriones se trataron de manera similar desde las primeras etapas de la gástrula y se puntuaron en las etapas de renacuajo 32-33. Comparado con el pez cebra, Xenopus los embriones fueron relativamente insensibles al VPA (en medio FETAX), requiriendo dosis de 20 a 100 veces más altas para efectos similares (Fig. 2 y datos no mostrados). Sin embargo, encontramos que el medio de cultivo afecta la sensibilidad de los embriones de rana al VPA. Específicamente, el medio FETAX, que se desarrolló para la detección de sustancias tóxicas (21), requiere una concentración aproximadamente cinco veces mayor de VPA para producir un fenotipo dado que 0,1 × MMR (datos no mostrados). Los experimentos posteriores se llevaron a cabo utilizando 0,1 x MMR a menos que se indique lo contrario.

En ambos Xenopus y pez cebra, se observa un gran retraso inducido por VPA, y los embriones tratados con VPA tienen defectos en el enrollamiento intestinal y ejes A / P más cortos, así como colas dobladas y algunos defectos oculares (Fig. 1). Los embriones tratados con VPA también han alterado la pigmentación, ya sea que se reduce en la mayor parte del cuerpo o parece concentrada en la parte superior de la región de la cabeza. Xenopus Los embriones tratados con VPA 2 mM y los embriones de pez cebra con VPA 0,2 mM desarrollan derrames pericárdicos que se manifiestan como un área de edema que rodea la región del corazón, similar a los efectos en ratones mutantes para el gen homeobox. Brincar y embriones de pez cebra inyectados con morfolinos anti-Hop (27).

Diferentes análogos de VPA y TSA inducen la acetilación de histonas en Xenopus y embriones de pez cebra en diversos grados

Si el VPA es teratogénico debido a su actividad inhibidora de HDAC, predijimos que los análogos de VPA menos inhibidores serían menos teratogénicos y que otros inhibidores de HDAC serían igualmente teratogénicos. Para probar esta hipótesis, primero necesitábamos definir las condiciones bajo las cuales la acetilación de histonas se ve afectada in vivo por los compuestos relevantes. El orden de potencia para la inhibición de HDAC in vitro y en células cultivadas es VPM & lt (4PA, 2EH) & lt VPA & lt NaBu (28). Determinamos los efectos de los análogos de VPA sobre la inhibición de HDAC en embriones analizando la acetilación de histonas. Los embriones se trataron con dosis iguales de análogos de VPA desde la etapa 21-22 hasta la etapa 32-33, y las histonas se extrajeron y se sometieron a inmunotransferencia para detectar la histona H4 acetilada. Encontramos que los efectos relativos sobre la acetilación de histonas in vivo (Fig.2A) coincidieron con los observados anteriormente en células en cultivo (28). Por tanto, el VPA induce una fuerte acetilación de histonas. VPM, un compuesto estructuralmente similar a VPA, pero con una amida en lugar de un resto de ácido carboxílico, no tiene efecto, mientras que 4PA y 2EH tienen un efecto intermedio. El butirato de sodio, un inhibidor de HDAC estructuralmente relacionado con el VPA, así como el TSA, un inhibidor de HDAC estructuralmente diferente del VPA, tienen efectos similares al VPA sobre la acetilación de histonas a las concentraciones utilizadas (Fig.2A ver también ref 29). Estimamos en base a la cuantificación de transferencias Western que VPA, NaBu y TSA aumentan la acetilación de la histona H4 en relación con los controles de 25 a 35 veces, 4PA de 5 a 10 veces y VPM & lt2 veces. Por tanto, el VPA y los análogos inhiben las HDAC en embriones de forma similar a sus efectos sobre las enzimas in vitro.

El 50% de los embriones presentan los fenotipos mostrados en Figura 1. Los embriones se recolectaron y las histonas se extrajeron y se sometieron a inmunotransferencia para la histona H4 acetilada. Se cargaron de dos a cuatro equivalentes de embriones por carril. Se muestra un control de carga (histona H4 total). B) Western blot para acetil-histona-H4 extraída de embriones de pez cebra tratados como en Figura 1 mostrando niveles aumentados en respuesta a los inhibidores de HDAC. Al igual que con Xenopus, Los tratamientos con TSA y VPA que dan fenotipos comparables provocan elevaciones similares de acetilación de histonas. C) Defectos graves inducidos en Xenopus los embriones corresponden a la potencia inhibidora de HDAC in vivo. Xenopus los embriones se trataron con 2 mM de VPA o análogos de VPA o TSA 100 nM desde la etapa 21-22 hasta la etapa 32-33 durante 18 h. VPA, TSA y NaBu tienen fuertes efectos teratogénicos, mientras que los análogos de VPA con escasa actividad inhibidora, VPM y 4PA, tienen poco o ningún efecto importante sobre el desarrollo. D) VPA, análogos de VPA y TSA afectan el bucle cardíaco. Xenopus los embriones se trataron con dosis 2 mM de VPA y análogos desde el estadio 21-22 hasta el estadio 32-33 durante 18 h. Los embriones se fijaron en la etapa 36 y se marcaron con una sonda antisentido contra el marcador de troponina cardíaca mediante hibridación in situ. VPA, TSA y NaBu previenen la formación de bucles cardíacos, como lo muestra una tira alargada de tinción en la zona ventral (más bajo) parte de los paneles. Los controles y los análogos de VPA con actividad inhibidora de HDAC débil o nula tienen corazones en bucle de aspecto normal que se ven como un parche compacto de tinción.

También establecimos concentraciones de VPA y TSA que inducen una elevación similar de la acetilación de histonas en el pez cebra (Fig.2B). Curiosamente, mientras que los peces cebra son más sensibles que Xenopus a VPA en nuestras condiciones, son menos sensibles a TSA, requiriendo concentraciones más altas (micromolar bajo frente a submicromolar) para lograr niveles comparables de acetilación de histonas inducida por VPA. Esto se debe presumiblemente a una combinación de diferencias de especies en la absorción y el metabolismo de cada compuesto (relacionadas con las diferencias, por ejemplo, en la relación superficie-volumen, la permeabilidad de la membrana vitelina de la rana frente al corion de pescado y la tasa de división celular de estas dos especies).

Los efectos de diferentes análogos de VPA y TSA en el desarrollo: correlación con la inhibición de HDAC

Nosotros tratamos Xenopus embriones con análogos de VPA y TSA para determinar si los efectos de VPA y otros compuestos sobre el desarrollo embrionario se correlacionan con sus efectos sobre la inhibición de HDAC. Los embriones se trataron con varios análogos de VPA y TSA en paralelo con VPA. Comparamos los fenotipos resultantes en función del aspecto macroscópico, la morfología cardíaca y la pigmentación. Encontramos que el desarrollo anormal se correlacionó estrechamente con la actividad inhibidora de HDAC. Por lo tanto, VPM 2 mM (un inhibidor débil o no) no tuvo ningún efecto manifiesto sobre los embriones, mientras que los embriones tratados con 4PA 2 mM y 2EH 2 mM (inhibidores moderados) se retrasaron en su desarrollo (Fig.2C). La mayoría de los embriones tratados con 2EH 1 o 2 mM también tienen pigmento reducido (sin embargo, 2EH 2 mM era a veces citotóxico, dependiendo de la nidada de huevos). Algunos embriones tratados con 2EH tenían un derrame pericárdico más leve que en los embriones tratados con VPA, así como defectos en la cola y los ojos doblados. En general, el fenotipo causado por 2EH es más fuerte que el causado por 4PA. Los efectos de cualquiera de los compuestos son más leves que los del tratamiento con VPA 2 mM. Los embriones tratados con NaBu 2 mM o TSA 100 nM desarrollan derrame pericárdico, pigmento reducido y enrollamiento intestinal anormal, algunos tienen defectos en la cola y los ojos doblados muy similares a los observados con VPA 2 mM (Fig.2C).

Para evaluar los efectos de los tratamientos sobre el desarrollo del corazón con más detalle, examinamos la expresión de la troponina cardíaca, un marcador del miocardio. El nivel de expresión de la troponina cardíaca no se ve afectado, sin embargo, la morfología del corazón, a juzgar por la tinción de troponina, es diferente en los embriones tratados con VPA. Por lo tanto, el patrón de tinción de troponina en corazones de embriones no tratados tiene una forma triangular, mientras que el patrón de tinción en los embriones tratados con VPA 2 mM es alargado y tubular, lo que sugiere defectos en el bucle del corazón (Fig.2D). La expresión de troponina cardíaca en embriones tratados con 4PA 2 mM y 2EH 2 mM muestra que la morfología de sus corazones es similar a la de los corazones de embriones tratados con VPA 1 mM, es decir, el efecto es intermedio en comparación con el efecto del tratamiento con VPA 2 mM (Fig. 2D). Los fenotipos de los embriones tratados con NaBu 2 mM y TSA 100 nM se parecen mucho al fenotipo de los embriones tratados con VPA 2 mM. Juntos, los datos anteriores muestran que los efectos sobre Xenopus El desarrollo embrionario de los compuestos probados se correlaciona estrechamente con su capacidad para inhibir las HDAC. Se generó una serie fenotípica esencialmente idéntica para los embriones de pez cebra usando concentraciones de inhibidor de HDAC que dieron niveles similares de acetilación de histonas in vivo (datos no mostrados). Es importante destacar que en ambas especies, las dosis de cada compuesto que dieron niveles similares de acetilación de histonas también produjeron fenotipos similares.

Efectos de VPA y TSA en todo el transcriptoma

Para probar si la similitud fenotípica a nivel anatómico general no ocultaba las diferencias a nivel de gen entre los efectos de diferentes inhibidores de HDAC, ampliamos nuestro análisis más allá de los efectos morfológicos del VPA a los del transcriptoma. Elegimos el análisis de microarrays para proporcionar una medida imparcial y casi completa del grado de correlación entre los efectos de la inhibición de VPA y HDAC por otros medios. Como control, elegimos TSA debido a su falta de relación estructural con, pero la actividad inhibidora de HDAC bioquímica in vivo compartida con, VPA como se describió anteriormente. Los embriones de cada especie se trataron con diferentes dosis de VPA y TSA de etapas tardías de gástrula y se recolectaron en etapas de capullo de cola / 24 h. Se extrajo ARN de grupos de embriones y se aplicaron sondas de ADNc a Affymetrix Gene Chips para comparar. Normalizamos los niveles de intensidad de los chips utilizando el paquete GCRMA (24). Este programa utiliza un algoritmo de corrección de fondo basado en diferencias de coincidencia / desajuste de sonda que es algo diferente del software Affymetrix MAS, ya que tiene una cuenta más sofisticada de señales de hibridación de desajuste espurias o ruidosas (ver comparaciones de GCRMA y MAS 5.0 en http: // affycomp.biostat.jhsph.edu/). Filtramos los valores de expresión resultantes para eliminar las señales de expresión débiles, que es más probable que sean propensas al ruido experimental. Los datos filtrados representan una estimación menos completa pero más conservadora de los verdaderos cambios medidos por las matrices. Este filtro excluye aproximadamente un tercio de los genes representados en los chips, lo que deja 10,837 de 15,611 Xenopus genes y 9791 de 15,617 genes de pez cebra para un análisis más detallado. Presentamos las comparaciones de expresión resultantes en la Fig. 3. Además, calculamos y presentamos coeficientes de correlación para el subconjunto de genes con expresión génica muy alterada (& gt2 veces) (Fig. 3 y 6). Descubrimos que dicha filtración elimina eficazmente la dependencia del lote para los valores de expresión (Fig.3A).

Figuras 3B y 3C comparar los efectos sobre la expresión génica de cada uno de los teratógenos VPA y TSA a varias dosis en cada una de las especies. El resultado sorprendente es la estrecha correspondencia entre los efectos de los dos inhibidores de HDAC. Para genes altamente perturbados (& gt2-fold), los coeficientes de correlación están muy por encima de 0.90, e incluso incluyendo los genes menos perturbados, el coeficiente de correlación es 0.90 ± 0.03 y 0.87 ± 0.03 para Xenopus y pez cebra, respectivamente. El grado de concordancia entre los diferentes teratógenos es lo suficientemente fuerte como para ser similar al que existe entre diferentes dosis o réplicas directas de un teratógeno dado (comparar la Fig.3B y 3C con la Fig.3A). Esto sugiere que los efectos medidos por micromatrices de los dos compuestos diferentes en una especie dada son tan similares como réplicas del mismo compuesto.

Para proporcionar medidas estadísticas adicionales de esta concordancia, utilizamos el método de producto de rango de Breitling et al. (25) para determinar en qué medida los genes expresados ​​diferencialmente bajo el tratamiento VPA eran los mismos que los expresados ​​diferencialmente bajo el tratamiento TSA. Encontrar un punto de corte, o umbral, que defina si un gen se expresa diferencialmente o no es un problema difícil y la respuesta suele ser específica de las condiciones experimentales. Un enfoque general que se ha utilizado ampliamente es seleccionar un umbral que controle una medida de significación estadística conocida como tasa de descubrimiento falso (FDR, consulte Materiales y métodos) en algún nivel predefinido. Para este experimento y los siguientes, tenemos múltiples factores: diferentes puntos de tiempo, diferentes organismos y diferentes compuestos. El método de producto de rango permite el cálculo de umbrales que son comparables en estas condiciones (consulte Materiales y métodos). Establecimos el FDR en el nivel muy estricto de 0,05 (es decir, 5%) y luego evaluamos la similitud de la expresión diferencial de genes regulados por incremento y regulados por disminución se analizaron por separado.

Los resultados son sorprendentes. La proporción de genes expresados ​​diferencialmente en común con ambos fármacos (es decir, VPA y TSA) fue del 60 al 78% y del 73 al 81% para Xenopus y pez cebra, respectivamente. Esto se compara con un Xenopus proporción de lote a lote de 49–70% (consulte las tablas en Datos complementarios para obtener más detalles). Por tanto, este análisis estadístico confirma los datos de correlación, lo que indica que la mayoría de los genes afectados por VPA también son objetivos de TSA.

El diseño de dosis-respuesta del experimento proporcionó un método adicional de comparación: cuando se grafican los efectos de los fármacos sobre la expresión de los 1000 genes más fuertemente afectados para cada especie con respecto a la dosis del fármaco, los perfiles son sorprendentemente similares. Figura 4ANUNCIO muestra gráficos para los 19 genes más estimulados y más inhibidos para cada una de las especies, pero las similitudes son aún más claras cuando se examinan todos los gráficos (ver Datos complementarios). Por inspección, queda claro que la gran mayoría de los genes muestran respuestas muy similares a los tratamientos farmacológicos. Hay algunas excepciones (p. Ej., El gen n. ° 12 en la figura 4A), pero solo 4 genes de 2000 trazados de esta manera muestran tendencias opuestas (ver Datos suplementarios). Para la mayoría de los genes, los perfiles de dosis-respuesta para ambos compuestos son monótonos (aumento o disminución constante, con o sin una meseta) sin diferencias o con diferencias cuantitativas modestas entre los compuestos. Curiosamente, hay varios genes que muestran cambios concordantes para los dos compuestos a pesar de responder de manera no monotónica con la dosis (por ejemplo, el gen n. ° 9 en la Fig.4B ver también Datos suplementarios). These, together with the close parallels in the dose-response profiles for the majority of genes, reinforce the notion that these two structurally contrasting HDAC inhibitors act very similarly at the transcriptome level.

It has been reported that a prominent effect of VPA on zebrafish embryos is global retardation of development ( 10 ), and this is a common effect of VPA in several species in the literature. It therefore might be argued that any number of agents that cause developmental retardation would give similar effects, making the correlation we observed between VPA and TSA a nonspecific effect. To control for this possibility, we compared the effect of the two compounds with pure retardation, that is, with expression levels in sibling embryos harvested at younger stages than the treated and control embryos (Fig. 3D). The correlation between younger (“retarded”) embryos and the drug treatments is less than that between the two different drug treatments. For highly (>2-fold) perturbed genes, correlation coefficients between VPA and retardation conditions are 0.86 ± 0.02 (compared with 0.97±0.01 between drugs). For all the genes, the numbers are 0.48 ± 0.03 (compared with 0.90±0.03 between drugs). Furthermore, using the Rank Product method, the proportion of differentially expressed genes in common to both drugs (60–78% and 73–81% for Xenopus and zebrafish, respectively, at 5% FDR) was substantially higher than the proportion of differentially expressed genes in common between VPA and retardation in Xenopus (28–55% at 5% FDR). In other words, VPA and TSA have effects that are more similar to one another than either is to pure developmental delay.

There was a marked correlation between expression profiles of untreated (stage 23) embryos compared with younger siblings (untreated stage 20, 19, and 18) (Fig. 3D). In other words, at the whole embryo level, gross gene expression changes over the stage 18–20 period are relatively subtle, perhaps because developmental changes are in small anatomical regions and so concealed by dilution, or many of the changes are in the location of expression rather than the level of a given gene. Therefore, to test whether VPA effects might more closely resemble retardation at the anatomical level, we examined anatomical differences in morphology and gene expression in VPA-treated zebrafish embryos. As previously reported, VPA-treated embryos grossly resembled embryos from specific earlier stages of development in a dose-dependent manner (Fig. 5A). However, upon examination of the expression of two well-characterized neural markers, Krox20 and Pax2, we found that the expression patterns in VPA-treated embryos were not merely retarded but qualitatively different from younger controls (Fig. 5B, 5C). Similar analysis in Xenopus embryos gave essentially identical results (data not shown). Thus, the differences between VPA treatment and retardation apply anatomically as well as at the level of the transcriptome. The above experiments show that the superficial resemblance of treated embryos to retarded embryos conceals numerous differences at the gene expression level, making the correlation between the effects of VPA and TSA that much more biologically significant.

To test for cross-species concordance in HDAC inhibitor effects, we defined a set of putative orthologs represented on both chips (

1277 genes) using the NIH Homologene database (see Materials and Methods). With this gene set, there was much lower correlation between species than within a species for either drug treatment (Fig. 6A, 6B vs. Fig. 3). Furthermore, using the Rank Product method, whereas the proportion of differentially expressed genes in common to both drugs was 60–78% and 73–81% for Xenopus and zebrafish, respectively, at 5% FDR, no putative orthologs were differentially expressed due to either VPA or TSA at 5% FDR (see Supplemental Data). To test whether this lower correlation could be due to misidentification of homologues as orthologs, we plotted concordance as a function of sequence similarity (Fig. 6C). We observed only minimal increase in cross-species concordance when taking subsets of the genes with increasing sequence, i.e., showing that more stringent percentage sequence homology criteria do not substantially change the outcome. Other factors presumably limit this concordance (see Discussion).


PROCEDIMIENTOS EXPERIMENTALES

Embryo manipulations

Xenopus husbandry and egg procurement was carried out in accordance with the guidelines of the University of Pennsylvania Institutional Animal Care and Use Committee (IACUC approved protocols #260500 (approved 5/9/2007-5/9/2010) and #800878 (approved 2/28/2008-2/18/2011). Embryos were obtained, cultured, and microinjected as described previously (Sive et al., 2000). Embryos were staged according to Nieuwkoop and Faber (Nieuwkoop and Faber, 1994). Capped mRNAs were produced by in vitro transcription using the mMessage mMachine Kit (Ambion). Each injected blastomere received 10 nl of RNA. Embryos were injected either equatorially (for whole embryo experiments) or in the animal pole (for explant experiments) in each blastomere of 2-cell stage embryos. Ectodermal explant assays were performed as described previously (Sive et al., 2000). Explants were excised using a Gastromaster tip at st. 8, cultured until tailbud stages (st. 28-31), and collected for quantitative RT-PCR. Drug treatments were performed from stage 10 to stage 12 unless otherwise noted. Final concentrations used in each treatment were as follows: 2mM valproate (Sigma) 100 nM trichostatin A (Sigma) 2mM valpromide (gift from Katwijk Chemie B.V.) 2mM VAHA 250 uM for each Compound60 and CI995.

Mice were used in accordance with the guidelines of the University of Rochester School of Medicine and Dentistry Institutional Animal Care and Use Committee (IACUC approved protocol # 2007-027R 100636 (approved 5/9/2007-5/9/2012). Timed pregnant ICR mice (Taconic Farms) were killed by CO2 inhalation at day 7.5 of gestation, and neural plate stage embryos were dissected into yolk sac and embryo proper fractions as previously described (Palis et al., 1995). Individual yolk sacs were cultured in 100 μL of Iscove modified Dulbecco medium supplemented with 15% serum replacement (Invitrogen), 5% plasma-derived serum (Antech), 16% BIT (Stem Cell Technologies), 50ug/ml ascorbic acid (Sigma), 0.5% Protein Free Hybridoma Medium II, (Invitrogen), 2mM glutamine (Invitrogen), 0.1mM monothioglycerol, 2 U/mL erythropoietin, and 100 ng/mL stem cell factor in a 96-well plate for 48 hours in 5% CO2, room air, 37ଌ. VPA at 0, 0.4, and 0.8 mM was added to similarly staged individual explants at the start of the culture. At the end of the culture period, each yolk sac explant was trypsinized into single cells, and total cell number and cell viability were quantified. Eighty percent of the explanted cells were plated in methylcellulose supplemented with 10% plasma-derived serum, 5% protein-free hybridoma media II (Gibco Invitrogen), 2mM glutamine, 2 U/mL erythropoietin, 100 ng/mL stem cell factor, 10 ng/mL interleukin-3 (IL-3), 10 ng/mL IL-6, and 5 ng/mL granulocyte-macrophage colony-stimulating factor, 0.1mM monothioglycerol and were cultured in 5% CO2, room air, 37ଌ. Primitive erythroid and macrophage colonies were quantified at 5 and 7 days of culture, respectively, as previously described (Palis and Koniski, 2005).

In-situ hybridization, benzidine staining, and immunoblotting

Anti-sense probes using Digoxygenin-UTP (Roche) were synthesized using the Megascript Kit (Ambion). Plasmids used in these studies were kind gifts from the following colleagues: we thank Jean-Pierre Saint-Jeannet for Xlim1 and Xpo, Paul Krieg for aplnr and nkx2.5, Richard Harland for noggin and Hoxb9, Paul Mead for gata1, Eddy DeRobertis for chd, Frank Conlon for Tbx20, Christoph Niehrs for Vent2, and Monica Vetter for Xrx. Whole-mount in situ hybridization was performed as described previously (Harland, 1991). Benzidine staining was performed as described on http://www.xenbase.org/xenwiki/index.php/Protocols. Color development was allowed to proceed for 3 minutes. Histone isolation was performed as described previously, with little modification (Gurvich et al., 2004). Briefly, 20 embryos were lysed, acid extracted overnight, and precipitated with trichloroacetic acid. 0.5 embryo equivalent was used for immunodetection by anti-H3acK9/14 antibody (Millipore) and anti-H3 antibody (Cell Signaling). Immunoblotting was performed as described previously (Fass et al., 2011). 10 embryos were lysed 0.5 or 1 embryo equivalent was detected with anti-HDAC3 (Cell Signaling) or anti-HDAC1/2 (Millipore). Ponceau S (Sigma) staining was performed to ensure equal protein loading.

RNA quantitation

Quantitative RT-PCR (qRT-PCR) was performed as described previously (Blythe et al.). Primers for these studies included: Alpha globin T3: forward: CATGCCTACAACCTGAGAGTG: reverse:GAATTTGTCCCAAGCAGCAT. Ornithine decarboxylase (ODC): forward:GATCATGCACATGTCAAGCC reverse:TCTACGATACGATCCAGCCC. Runx1: forward:CATATCTCCAGGAAGGGCAA reverse:AATGCCAACTCGAGGATCAC. Ncam: forward:GCTGTGGCTAGTGGGAAAGC reverse:TGTTTCCTCTGGCTTAGAGTTTT. For each experiment, individual samples were analyzed in triplicate. Data were analyzed by first normalizing to the house-keeping gene ODC as loading control, and then calculating fold change compared to the indicated control condition using the Δ㥌(t) method (reviewed in (Taneyhill and Adams, 2008)). Embryonic cDNA was synthesized using oligo(dT)15mer primers as described (Yang et al., 2002).

Bullet points

Class I Histone Deacetylase (HDAC) activity contributes to primitive erythropoiesis in Xenopus y mouse.

Exposure to valproic acid or other class I HDAC inhibitors specifically during gastrulation blocks primitive erythropoiesis.

HDAC activity contributes to an early step in primitive erythropoiesis.

Class I HDACs function downstream of BMP and Gata1


Abstracto

Background and Purpose—

A variant in the histone deacetylase 9 (HDAC9) gene is associated with large artery stroke. Therefore, inhibiting HDAC9 might offer a novel secondary preventative treatment for ischemic stroke. The antiepileptic drug sodium valproate (SVA) is a nonspecific inhibitor of HDAC9. We tested whether SVA therapy given after ischemic stroke was associated with reduced recurrent stroke rate.

Methods—

Data were pooled from 3 prospective studies recruiting patients with previous stroke or transient ischemic attack and long-term follow-up: the South London Stroke Register, The Vitamins to Prevent Stroke Study, and the Oxford Vascular Study. Patients receiving SVA were compared with patients who received antiepileptic drugs other than SVA using survival analysis and Cox Regression.

Results—

A total of 11 949 patients with confirmed ischemic event were included. Recurrent stroke rate was lower in patient taking SVA (17 of 168) than other antiepileptic drugs (105 of 530 log-rank survival analysis PAG=0.002). On Cox regression, controlling for potential cofounders, SVA remained associated with reduced stroke (hazard ratio=0.44 95% confidence interval: 0.3–0.7 PAG=0.002). A similar result was obtained when patients taking SVA were compared with all cases not taking SVA (Cox regression, hazard ratio=0.47 95% confidence interval: 0.29–0.77 PAG=0.003).

Conclusiones

These results suggest that exposure to SVA, an inhibitor of HDAC, may be associated with a lower recurrent stroke risk although we cannot exclude residual confounding in this study design. This supports the hypothesis that HDAC9 is important in the ischemic stroke pathogenesis and that its inhibition, by SVA or a more specific HDAC9 inhibitor, is worthy of evaluation as a treatment to prevent recurrent ischemic stroke.

Introducción

The Wellcome Trust Case Control Consortium 2 genome-wide association study reported an association between a genetic variant on chromosome 7p21.1 and an increased risk of ischemic stroke because of large artery disease. 1 The association was confined to large artery stroke and not present with cardioembolic or lacunar stroke. The association has been replicated in other cohorts of patients with stroke. 2,3 The same genetic variant has also been associated with increased carotid intima–media thickness and asymptomatic carotid plaque, 4 and less strongly, with coronary artery disease, 5 suggesting an action via increasing atherosclerosis. The underlying gene is thought to be histone deacetylase 9 (HDAC9 ). 4 Mice with a deficiency of the HDAC9 genHDAC9 −/− apolipoprotein E–deficient) exhibit reduced aortic atherosclerosis compared with HDAC9 +/+ apolipoprotein E–deficient mice that do not have a deficiency. 6 Furthermore, HDAC9 expression is upregulated in symptomatic carotid atherosclerotic plaques in man. 4

The antiepileptic drug (AED) sodium valproate (SVA) is a nonspecific inhibitor of HDAC9 activity 7 and has been shown to attenuate atherosclerosis in apolipoprotein E–deficient mice. 8 A large Danish study suggested that although epilepsy was associated with an increased risk of incident stroke, the extent of this effect varied with the type of AED that was prescribed. SVA was associated with a decreased risk of both stroke and myocardial infarction compared with carbamazepine. 9,10 A further large community study found a dose–response relationship with higher doses of SVA being associated with lower risks of incident stroke, but similar associations were also seen with some other AEDs, raising the possibility of survivor bias. 11

These findings raise the hypothesis that inhibiting HDAC9 activity might offer a novel preventative treatment for large artery atherosclerotic ischemic stroke. We sought to indirectly test this hypothesis by exploring the association between exposure to SVA and subsequent risk of recurrent stroke in 3 large cohorts of patients with prior stroke or transient ischemic attack (TIA).

Métodos

Data Sources

This project used data provided to us by 3 long-term follow-up stroke studies. Access to these separate data sources is therefore not available via this project.

Data were collected, and pooled, from 3 prospective studies recruiting patients with previous stroke or TIA and with long-term follow-up:

The SLSR (South London Stroke Register n=4972) was a prospective population-based cohort study to record first-ever strokes in Lambeth and Southwark, London, United Kingdom. 12 The final data set included data collected for patients with first-ever strokes between January 01, 1995, and September 30, 2014. Stroke diagnosis was confirmed by a study physician within 1 week of the event. Face-to-face follow-up took place at 3 months and then annually after the index event. For patients reaching at least 1 follow-up, the mean time from initial stroke to final follow-up was 4.6 years (SD=4.4 range=0–19)

The VITATOPS (Vitamins to Prevent Stroke Study n=8164) was a clinical trial recruiting patients based on any stroke or TIA within the 7 months preceding randomization. 13 Randomization took place between January 17, 1997, and December 29, 2008. Follow-up took place every 6 months from randomization to trial completion, either face-to-face or by telephone. For patients reaching at least 1 follow-up, the mean time from initial stroke or TIA to final follow-up was 3.4 years (SD=2.4 range=0–11)

The OXVASC (Oxford Vascular study n=2113) is a population-based study of acute vascular events in Oxfordshire. 14,15 The data set included here comprised all recruits ascertained between April 03, 2002, and March 31, 2012, with any first ischemic stroke or TIA in the study period. Multiple methods of follow-up were used, including face-to-face follow-up. Follow-up took place at 1, 6, 12, 24, 60, and 120 months. The mean time from initial stroke or TIA to final follow-up in this subset was 4.3 years (SD=3.4 range=0–12).

Ética

SLSR was approved by the following ethics committees: St Thomas’ Hospital, King’s College Hospital, Wandsworth, Riverside, and National Hospital for Neurology and Neurosurgery and the Institute of Neurology.

VITATOPS received ethics approval in the United Kingdom from the Multicentre Research Ethics Committee for Scotland, in New Zealand from the Multi-region Ethics Committee, and from local research ethics committees applicable to each participating center.

The Oxford Vascular Study was approved by the local research ethics committee (OREC A: 05/Q1604/70).

Data Extracted

Study Populations

Study entry date was recorded as the date of index stroke or TIA. Classification of initial stroke pathology as ischemic or hemorrhagic was taken from the Oxfordshire Community Stroke Project (OSCP) or TOAST classifications (Trial of ORG 10172 in Acute Stroke Treatment) according to which classification had the least missing data per study. Where this was not available, the cases were categorized as unclassified.

Study End Point-Stroke Recurrence

Recurrent stroke occurrence and TOAST classification of recurrent ischemic stroke were collected across all studies. Stroke recurrence was captured at follow-up and subsequently checked by study physicians. These were then subtyped based on the TOAST classification. 16 Data were censored if, without recurrence, the patient died, reached their final follow-up, or the study ended.

For the SLSR, stroke recurrence was defined as a new neurological deficit >24 hours after incident stroke and not considered to be because of edema, hemorrhagic transformation, or intercurrent illness. Recurrence within 21 days of the index stroke was only included if a different location was clearly indicated. For VITATOPS, recurrent stroke was defined as a new disturbance of focal neurological change lasting >24 hours or resulting in death and confirmed on imaging all of the recorded recurrences were >24 hours from the index event. For OXVASC, recurrent stroke was recorded as any new neurological event lasting >24 hours or resulting in death and confirmed by a study physician who reviewed the surviving patients, the case records, and imaging.

Antiepileptic Treatment

Prescription data for antiepileptic medication were available for all 3 studies. Prescription data were recorded at baseline and then each follow-up. For OXVASC, AED data were available at baseline and 1-year follow-up. For the SLSR records of SVA, carbamazepine, phenobarbital, phenytoin, gabapentin, lamotrigine, levetiracetam, and occasional less frequently prescribed medications (other) were available. For VITATOPS records of SVA, carbamazepine, phenobarbital, and phenytoin were available. For OXVASC, records of SVA, carbamazepine, phenobarbital, phenytoin, gabapentin, and lamotrigine were available.

Other Variables

Other variables included in the analyses were study, age, sex, and diagnosis of epilepsy. Diagnoses of epilepsy were captured separately to antiepileptic medication. This was defined either as an existing diagnosis at baseline, made by a qualified physician, or a diagnosis recorded at follow-up. For VITATOPS, seizures were recorded as adverse events at each follow-up. These were classified as epileptic seizures where they met the criteria for the International League Against Epilepsy, and no baseline data were available on this. For the SLSR, baseline diagnoses were taken from patient medical records, and subsequent diagnoses were collected via self-report at follow-ups. For the OXVASC study, this included people with a history of >1 seizure in later childhood or adult life recorded at baseline by self-report.

Análisis estadístico

Figure 1 shows the selection of patients, exposure groups, and recurrent events. Patients were excluded from analyses if they had a hemorrhagic qualifying event or were lost to first follow-up.

Figura 1. Flow cart of cases included in analysis. *Where prescription is before recurrent stroke or study end only. AED indicates antiepileptic drug OXVASC, Oxford Vascular Study SLSR, South London Stroke Register SVA, sodium valproate and VITATOPS, Vitamins to Prevent Stroke Study.

The SVA exposure population was defined based on any prescription of SVA before recurrent stroke or study end. This was calculated based on any SVA-recorded exposure in the period preceding the study outcome, death, or final follow-up. We used the date of the first follow-up where there was a prescription of SVA to calculate this. SVA prescribed after recurrence was not considered SVA exposure.

Our protocol specified analysis was as follows: The SVA exposure populations were compared with 2 minimally selective control populations to avoid bias. (1) all other patients this included everyone other than those receiving SVA and (2) all other AED prescriptions: defined as any record of AED prescription at any time from study entry to final follow-up, including those with dates after recurrence but excluding those with concurrent prescriptions of SVA. Because the cohorts we used were from non-AED studies, the precise start date for AED use was not available and recorded instead as the first follow-up visit at which their use was recorded. For this reason, we initially included AED use at any time as our control population

It follows that our minimally selective criteria for the control populations could result in the other AED population, including some patients for whom AED prescriptions might be given after recurrent stroke. We, therefore, performed further secondary analyses with more restrictive comparison populations. We first compared patients receiving SVA with patients receiving no AEDs only, defined as patients without any AED prescriptions recorded before the study end or recurrent stroke. Second, we compared patients receiving SVA with patients only receiving other AED before stroke or study end based on the date of follow-up that these prescriptions were recorded.

Survival time was calculated as the number of days from the date of the index event (stroke or TIA) to the date of recurrent stroke occurrence or censoring. Life tables were calculated to describe the cumulative stroke-free survival for the exposure groups at 1, 5, 10, and 15 years. Survival curves were estimated with Kaplan–Meier and groups compared using the log-rank test in SPSS version 22. Cox regression was carried to calculate adjusted risk of a recurrent stroke. SVA exposure (SVA versus control), age, sex, history of epileptic symptoms, initial event type (TIA or stroke), and study were included in the model.

A secondary prespecified analysis was to determine whether any protective associations with SVA were confined to patients with large artery stroke, as might be expected from the genetic association data. Therefore, we repeated analyses in patients with large artery stroke.

Post hoc Cox regression analyses were performed for each study population individually. Exposure to SVA was compared with all patients without SVA exposure. Covariates were as above.

Resultados

Descriptive Data

The study cohort and patients included in the analysis are shown in the flow chart and in Table 1. A total of 11 949 patients were included in the pooled analyses, all of whom had a confirmed ischemic event at entry and follow-up available. The number in the SVA group was 168, and for those on other AEDs was 530. The total number of outcome events were 17 of 168 for patients prescribed SVA 1470 of 11 781 for patients never prescribed SVA 105 of 530 for patients prescribed other AEDs at any time 1426 of 11 312 for patients not prescribed AEDs and 44 of 469 for patients prescribed other AED when selected as prestroke/study end.

Table 1. Pooled Background Data for OXVASC, VITATOPS, and SLSR

AED indicates antiepileptic drug OXVASC, Oxford Vascular Study SLSR, South London Stroke Register SVA, sodium valproate TOAST, Trial of ORG 10172 in Acute Stroke Treatment and VITATOPS, Vitamins to Prevent Stroke Study.

* All participants with other AED prescription recorded no combined treatment with SVA. Hypertension and hyperlipidemia based on premorbid treatment.

Survival Models

The cumulative stroke-free survival, based on yearly data, was greater for the SVA group than for patients not prescribed SVA. Data are shown in Table 2.

Tabla 2. Cumulative Survival for All Entry Events (% Stroke Free)

% Cumulative percentage stroke free based on yearly statistics. AED indicates antiepileptic drug and SVA, sodium valproate.

* Where prescription is confirmed before recurrent stroke only.

† Includes patients exposed to other AEDs and patients never exposed to any AEDs.

‡ All participants with other AED prescription recorded no combined treatment with SVA.

§ n entering analysis at beginning of time period.

For the nonselective control populations, Kaplan–Meier estimates were calculated for exposure to SVA, no exposure to SVA, and exposure to AED medication at any time. Log-rank tests showed that the difference between SVA exposure and no SVA exposure was not significant (χ 2 [1]=2.7 PAG=0.1) although there was a graphical trend indicating a difference in survival based on exposure at later time points and the difference between SVA exposure and any other AED exposure was significant (χ 2 [1]=9.6 PAG=0.002). For the survival plots, see Figures 2 and 3.

Figure 2. Survival curve comparing proportion of population free of recurrent stroke, in patients on sodium valproate (SVA) compared with those not on SVA.

For the selective control populations, Kaplan–Meier estimates were calculated for exposure to SVA, no exposure to AED medication, and exposure to any other AED medication prestroke/study end. A log-rank test showed that the difference between SVA exposure and no AED exposure was not significant (χ 2 [1]=2.91 PAG=0.088) although there was a graphical trend indicating a difference in survival at later time points, and the difference between SVA exposure and other AED exposure was not significant (χ 2 [1]=0.01 PAG=0.937).

Hazard Models Adjusted for Covariates

Cox hazard models were calculated and adjusted for covariates. For the nonselective control comparisons, 2 models were created to account for the overlap in the control groups. Exposure to SVA was associated with a reduced risk of stroke compared with all patients without SVA exposure (hazard ratio [HR]=0.50 95% confidence interval [CI], 0.31–0.82 Wald test, PAG=0.006). Exposure to SVA was associated with a reduced risk of stroke compared with the group prescribed other AEDs at any time (HR=0.41 95% CI, 0.25–0.71 Wald test, PAG=0.001). For the selective control comparison, a single model was created. Group status was significant (Wald=27.9 PAG<0.0001). SVA was associated with a reduced risk of stroke compared with no AED exposure (HR=0.48 95% CI, 0.35–0.67 Wald test, PAG<0.0001). Exposure to SVA was not associated with change in risk of stroke compared with other AED exposure group when selected as prestroke/study end (HR=1.2 95% CI, 0.66–2.02 Wald test, PAG=0.62).

Large Artery Stroke Analyses

Subgroup analyses were performed to determine whether any associations were specific to large artery stroke. For those patients with large artery index events, 17 patients were in the exposed to SVA group, 2830 were in the never exposed to SVA, of which 108 were exposed to AED medication other than SVA. Survival data are given in Table 3.

Tabla 3. Cumulative Survival for Cases With Large Artery Entry Events

% Stroke Free indicates cumulative percentage stroke free based on yearly statistics. AED indicates antiepileptic drug and SVA, sodium valproate.

* Where prescription is confirmed before recurrent stroke only.

† All participants with other AED prescription recorded no combined treatment with SVA.

Kaplan–Meier estimates were computed. Although survival curves diverged for the groups, with a trend to better outcomes for those exposed to SVA, the data were limited by the small sample sizes. For a comparison between the SVA-exposed group and all other non-SVA–exposed patients, a log-rank test showed that the difference between the 2 survival curves was not significant (χ 2 [1]=0.073 PAG=0.787). For a comparison between the SVA-exposed group and the other AED group, a log-rank test showed that the difference between the 2 survival curves was not significant (χ 2 [1]=1.16 PAG=0.281).

Post Hoc Analyses

Cox hazard models were calculated per study. Exposure to SVA was associated with a trend toward a reduced risk of stroke compared with all patients without SVA exposure for VITATOPS (HR=0.52 95% CI, 0.26–1.0 Wald test, PAG=0.052) and the SLSR (HR=0.33 95% CI, 0.12–0.92 Wald test, PAG=0.033) but not OXVASC (HR=1.2 95% CI, 0.40–3.4 Wald test, PAG=0.781).

Discusión

This analysis of 3 large cohorts of patients with prior stroke or TIA was undertaken to explore an a priori hypothesis (ie, the hypothesis was generated from published studies 1–11 before the epidemiological data were analyzed) that exposure to an inhibitor of HDAC, in the form of SVA, may be associated with a lower risk of recurrent stroke compared with nonexposure or to exposure to other AEDs. Although the design of our study is prone to systematic and random error and cannot infer causality, the results provide some evidence for the prestudy hypothesis and suggest that SVA, a nonspecific HDAC inhibitor, may be associated with a reduced stroke recurrence rate.

Previously, data have suggested that SVA reduces stroke risk in a stroke-free population, but this analysis provides new data suggesting that such an effect can also be found in patients who have already presented with ischemic stroke. This is particularly relevant if HDAC9 inhibition is to be considered as a potential secondary preventative treatment for stroke.

The results are broadly consistent with the results of 2 large population-based studies in Denmark and the United Kingdom. In a Danish study, SVA was associated with a lower risk of both myocardial infarction and stroke when compared with other AEDs. 9,10 In the British study, which used the Clinical Practice Research Database, SVA exposure was associated with a reduced risk of myocardial infarction but not ischemic stroke. 11 However, when a dose–response analysis was performed, longer exposure to SVA was associated with a reduced risk of ischemic stroke although similar associations were found with other AEDs raising questions about the specificity of the association.

In our study when comparing SVA use with all other patients with ischemic stroke and those patients with ischemic stroke on no AED, there was a highly significant reduced risk of stroke. This was replicated in our preplanned analysis comparing patients with SVA with those taking any other AED. Because of the use of cohorts collected for other study purposes, we did not have a precise start date for AEDs, and we therefore used the date of the follow-up at which the medication was recorded. For this reason, we initially included AED use at any time as our control population. However, when we performed further exploratory analyses in the data where the AED record dates were before recurrent stroke, the difference was no longer significant. This raises the possibility that the significant risk reduction seen in the SVA group compared with the 3 control groups might be because of some difference if patient characteristics between the 2 groups. Such bias are impossible to exclude in a cohort study, such as this, and confirming whether SVA does indeed reduce stroke risk will require a randomized trial design. One potential bias might be if stroke subtype differs in patients on SVA, for example, lacunar stroke might have a lower risk of epilepsy requiring AED therapy and a lower risk of stroke recurrence. However, there was no evidence of any difference in lacunar stroke frequency between groups (Table 1). A second possible issue is related to the collection of prescription dates which were based on follow-up rather than prescription date. Alternatively, it may be a possibility that other AEDs also have some inhibitory effect on HDAC9 although evidence for this is less clear. Notwithstanding, SVA exposure appeared overall to have a positive effect compared with no SVA exposure.

Strengths of this study include the prospective design, standardized diagnostic criteria for the qualifying TIA and stroke, and prolonged follow-up. Two of the 3 cohorts were population-based studies, reducing the risk of any selection bias. The third was a large randomized clinical trial that again incorporated prolonged follow-up.

However, the data sets also had some limitations. When examined separately as a post hoc analysis, 2 of the data sets yielded the same trend toward and effect for SVA, OXVASC did not. However, OXVASC had a small number of patients with confirmed SVA exposure (n=11), making it difficult to interpret in isolation. Sufficient data were not available to assess dose–response relationships, and therefore analyses were restricted to SVA prescribed at any time during follow-up. Because of the nature of data collection, often at annual follow-up, determining the exact start date of AED was not possible, and these were recorded as starting at the time the patient was first followed-up on that AED. Despite the large sample size of the >10 000 patients with stroke, the number of participants taking SVA and other AEDs was relatively few (in the hundreds) which limited statistical power. Furthermore, the number of cases of large artery stroke was too small to reliably test whether any protective effect was specific to this subtype, as hypothesized from the genetic association data. 1 It is also inherent in this type of data that the outcomes are more heavily weighted in the early years (because of early recurrence and long follow-up), but this is consistently the case across comparison groups. It may be that data sets with more power would benefit for an analysis splitting short- and long-term outcomes in relation to AED medication.

It is also acknowledged that SVA is a nonspecific HDAC inhibitor (inhibiting a wide range of HDACs) and has other actions, independent of HDAC9 inhibition. Hence, a more specific inhibitor of HDAC9 might have a stronger effect in reducing the risk of recurrent stroke. HDACs are a class of enzymes that remove acetyl groups from an ε-N-acetyl lysine amino acid on a histone, allowing the histones to wrap the DNA more tightly. There are 18 HDACs in humans. Eleven of the HDACs are zinc dependent, classified on the basis of homology to yeast HDACs: class I includes HDACs 1, 2, 3, and 8 class IIA includes HDACs 4, 5, 7, and 9 class IIB, HDACs 6 and 10 and class IV, HDAC11. 17

This study provides some support for the hypothesis that HDAC9 is important in the pathogenesis of ischemic stroke and that its inhibition, by SVA or a more specific HDAC9 inhibitor, is worthy of evaluation as a treatment to prevent recurrent ischemic stroke. However, because of limitations in a cohort study of this design, and possible unidentified bias, determining whether HDAC9 inhibition does reduce stroke risk requires randomized controlled trials of SVA or other HDA9 inhibitors.

Figura 3. Survival curve comparing proportion of population free of recurrent stroke, in patients on sodium valproate (SVA) compared with those on other antiepileptic drug (AED).

Expresiones de gratitud

We thank Adina Feldman for assistance in data management and analysis. Dr Markus is supported by a National Institute for Health Research (NIHR) Senior Investigator award and the NIHR Biomedical Research Centre at Cambridge. Dr Rothwell is in receipt of an NIHR Senior Investigator Award and a Wellcome Trust Senior Investigator Award. Dr Wolfe is supported by the NIHR Biomedical Research Centre at Guy’s and St Thomas’ National Health Service Foundation Trust and King’s College London. The views expressed are those of the author(s) and not necessarily those of the National Health Service, the National Institutes of Health Research, or the Department of Health.

Recursos de fondos

This project was funded by a British Heart Foundation (PG/13/30005). The VITATOPS trial (Vitamins to Prevent Stroke Study) was funded by the National Health and Medical Research Council of Australia Project Grants 110267 (2000–2004) and 403913 (2006–2008) and Program Grants 251525 (2003–2007) and 454417 (2007–2011). The Oxford Vascular Study has been funded by Wellcome Trust, Wolfson Foundation, UK Stroke Association, British Heart Foundation, and NIHR Oxford Biomedical Research Centre and supported by the facilities of the Acute Vascular Imaging Centre, Oxford.

Divulgaciones

Drs Markus and Wolfe received funding from the British Heart Foundation as above to fund this project. The other authors report no conflicts.

Notas al pie

Guest Editor for this article was Emmanuel Touze, PhD.


Histone deacetylase inhibitors: Potential in cancer therapy

The role of histone deacetylases (HDAC) and the potential of these enzymes as therapeutic targets for cancer, neurodegenerative diseases and a number of other disorders is an area of rapidly expanding investigation. There are 18 HDACs in humans. These enzymes are not redundant in function. Eleven of the HDACs are zinc dependent, classified on the basis of homology to yeast HDACs: Class I includes HDACs 1, 2, 3, and 8 Class IIA includes HDACs 4, 5, 7, and 9 Class IIB, HDACs 6 and 10 and Class IV, HDAC 11. Class III HDACs, sirtuins 1–7, have an absolute requirement for NAD + , are not zinc dependent and generally not inhibited by compounds that inhibit zinc dependent deacetylases. In addition to histones, HDACs have many nonhistone protein substrates which have a role in regulation of gene expression, cell proliferation, cell migration, cell death, and angiogenesis. HDAC inhibitors (HDACi) have been discovered of different chemical structure. HDACi cause accumulation of acetylated forms of proteins which can alter their structure and function. HDACi can induce different phenotypes in various transformed cells, including growth arrest, apoptosis, reactive oxygen species facilitated cell death and mitotic cell death. Normal cells are relatively resistant to HDACi induced cell death. Several HDACi are in various stages of development, including clinical trials as monotherapy and in combination with other anti-cancer drugs and radiation. The first HDACi approved by the FDA for cancer therapy is suberoylanilide hydroxamic acid (SAHA, vorinostat, Zolinza), approved for treatment of cutaneous T-cell lymphoma. J. Cell. Biochem. 107: 600–608, 2009. © 2009 Wiley-Liss, Inc.